sequence

2,072 triples
GPTKB property

Alternative names (21)
exampleSequence moveSequence relatedSequence sequence length sequence name sequence type sequence values sequenceAvailableAt sequenceAvailableIn sequenceFormula sequenceIn sequenceInOEIS sequenceLength sequenceName sequenceOEIS sequencePattern sequenceStart sequenceType sequenced sequencer 序列 more

Random triples
Subject Object
gptkb:A007632 293318625600
gptkb:AAC-SSR protein-coding
gptkb:A007568 16
gptkb:A000594_(OEIS) 1, -24, 252, -1472, 4830, -6048, -16744, 84480, -113643, 115920, ...
gptkb:A000055 Number of trees with n unlabeled nodes
gptkb:OEIS:A008908 15
gptkb:A006005 1
gptkb:Sox2 protein-coding
gptkb:Guðrúnarkviða_II Second of the Guðrún poems
gptkb:Heracles'_sixth_labor sixth of the Twelve Labors
gptkb:A000367 461
gptkb:thyrotropin-releasing_hormone pyroglutamyl-histidyl-proline amide
gptkb:Janazah_(funeral)_Salah intention, four takbirs, recitations, tasleem
gptkb:miR-200a UAAUACUGCCUGGUAAUGAUGA
gptkb:CCW4 220 amino acids
gptkb:ARMB gptkb:GenBank
gptkb:A000367 751
gptkb:SNORD116 gptkb:non-coding_RNA
gptkb:A000367 401
gptkb:Cro_protein 66 amino acids

Please wait…