Alternative names (21)
exampleSequence • moveSequence • relatedSequence • sequence length • sequence name • sequence type • sequence values • sequenceAvailableAt • sequenceAvailableIn • sequenceFormula • sequenceIn • sequenceInOEIS • sequenceLength • sequenceName • sequenceOEIS • sequencePattern • sequenceStart • sequenceType • sequenced • sequencer • 序列 • moreRandom triples
| Subject | Object |
|---|---|
| gptkb:A007632 | 293318625600 |
| gptkb:AAC-SSR | protein-coding |
| gptkb:A007568 | 16 |
| gptkb:A000594_(OEIS) | 1, -24, 252, -1472, 4830, -6048, -16744, 84480, -113643, 115920, ... |
| gptkb:A000055 | Number of trees with n unlabeled nodes |
| gptkb:OEIS:A008908 | 15 |
| gptkb:A006005 | 1 |
| gptkb:Sox2 | protein-coding |
| gptkb:Guðrúnarkviða_II | Second of the Guðrún poems |
| gptkb:Heracles'_sixth_labor | sixth of the Twelve Labors |
| gptkb:A000367 | 461 |
| gptkb:thyrotropin-releasing_hormone | pyroglutamyl-histidyl-proline amide |
| gptkb:Janazah_(funeral)_Salah | intention, four takbirs, recitations, tasleem |
| gptkb:miR-200a | UAAUACUGCCUGGUAAUGAUGA |
| gptkb:CCW4 | 220 amino acids |
| gptkb:ARMB | gptkb:GenBank |
| gptkb:A000367 | 751 |
| gptkb:SNORD116 | gptkb:non-coding_RNA |
| gptkb:A000367 | 401 |
| gptkb:Cro_protein | 66 amino acids |